We’ve updated our Terms of Use to reflect our new entity name and address. You can review the changes here.
We’ve updated our Terms of Use. You can review the changes here.

Unfinished YTPs (2008​-​2009) -​-​AMV​-​-

from handy recorder by YouTube Community

/

lyrics

Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).

credits

from handy recorder, released August 20, 2019

license

tags

about

Cotton Wing Nong Pa Ko, Thailand

est 2019

use code "creeper" for 95% off on all purchases

contact / help

Contact Cotton Wing

Streaming and
Download help

Report this track or account