Get all 17 Cotton Wing releases available on Bandcamp and save 50%.
Includes unlimited streaming via the free Bandcamp app, plus high-quality downloads of Mexican Deliberations, tr/fs, The significance of our predicament is not lost on me; for I know more than you; I am in the same place I was 3 decades ago, handy recorder, laboratory actions, telesahel, Y2K is Upon Us, oxygen loss, and 9 more.
1. |
Movie_clips
01:35
|
|||
2. |
||||
Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).
|
||||
3. |
Paradise Pier Hotel
01:08
|
|||
Epsteinian dialectics. Epsteinian dialectics. Clinton-ese pedophilic New World Order of North America and the Caribbean Islands. For your convienience, this DVD has been enhanced with HiT Entertainment's autoplay. Your program and a selection of bonus features will begin automatically. To bypass autoplay, select the main menu button at any time. Your feature presentation will begin in a moment. Enjoy!
|
||||
4. |
Black Ops Montage
01:58
|
|||
5. |
Obnoxious Orange
10:33
|
|||
6. |
Obnoxious Orange
08:02
|
|||
7. |
Tutorial
01:30
|
|||
8. |
Streaming and Download help
Bandcamp Daily your guide to the world of Bandcamp